Haplogrupo R1b (ADN-Y)

Origem: Wikipédia, a enciclopédia livre.
Ir para: navegação, pesquisa
Europa Y-DNA. Puzzles Princípio - As áreas destacadas, onde a freqüência de haplogrupos representam mais de um terço do pool genético (> 35%)
Haplogrupo R1b

Haplogroup R1b (Y-DNA).PNG

Tempo de origem < 18,500 anos[1]
Lugar de origem Sudoeste Asiático[2]
Ancestral R1
Descendentes R1b1a (R-P297), R1b1b (R-M335), R1b1c (R-V88)
Mutações definidas M343
Alta frequência Europa ocidental, Norte dos Camarões, Bashkires do Cazaquistão

Haplogrupo R1b (Y-DNA) é a linhagem paterna dominante da Europa Ocidental. Em genética humana o haplogrupo R1b é o mais frequente haplogrupo do cromossomo Y na Europa Ocidental e em partes da África sub-saariana Central (por exemplo em torno de Chad e Camarões). R1b também está presente em freqüências mais baixas em toda a Europa Oriental, Ásia Ocidental, Ásia Central e partes do norte da África, Sul da Ásia e Sibéria. Devido à emigração Europeia também atinge altas frequências nas Américas e na Austrália. Enquanto a Europa ocidental é dominada pela R1b1a2 ramo (R-M269) de R1b, a área de língua Chadic na África é dominada pelo ramo conhecido como R1b1c (R-V88). Estes representam dois "galhos" muito bem sucedidos em uma muito maior "árvore genealógica".

Fundamentos[editar | editar código-fonte]

O haplogrupo R1b é definido pelo marcador genético, M343 anunciado em 2004[3] , o qual define um polimorfismo binário específico no cromossomo Y. É agora definido como o haplogrupo R1b do cromossomo Y (anteriormente conhecido como Hg1 e Eu18).[4] Este marcador genético é portado pela maioria dos Europeus Ocidentais. É portado por 60% da população inteira de Portugal e de França, 70% da população inteira da Inglaterra e 90% de algumas partes de Espanha e Irlanda.

Estima-se que este marcador tenha se originado em um indivíduo masculino na Europa Ocidental há menos de 18.500 anos.

Também é dito que Europeus com a mutação M343 descendem de dez homens cujas raízes nos recuariam para a mutação M9 em algum lugar das estepes Khirgan quando uma grande divisão de pessoas tomaram seus próprios caminhos para o leste, norte e oeste.

Os detalhes técnicos do M343 são:

  • Mudança de nucleotídeo: C a A
  • Posição (par de bases): 402
  • Tamanho total (pares de bases): 424
  • Forward 5′→3′: tttaacctcctccagctctgca
  • Reverse 5′→3′: acccccacatatctccagg

Isto refere-se a um particular fragmento de DNA de pares de bases que a reação em cadeia da polimerase produz quando um usa as duas cadeias "primárias" listadas.

M343 foi anunciado em um grupo de 21 novos marcadores do cromossomo Y em um artigo de Cengiz Cinniolu em conjunto com outros autores[5] e tem sempre sido usado em aplicações tais como o Projeto Genográfico. Note-se que M343 e M242 foram os únicos dois marcadores deste artigo usados por tal projeto.

Ver também[editar | editar código-fonte]

Haplogrupos ibéricos.png

Haplogrupos do cromossoma Y humano

cromossoma Y comum a todos os homens
I J LT K-M526
R1 R2
R1a R1b

Ligações externas[editar | editar código-fonte]


  1. (2008) "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–8 pp.. DOI:10.1101/gr.7172008. PMID 18385274.
  2. International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades
  3. Cinnioğlu, Cengiz; et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114 (2): 127-148 pp.. DOI:10.1007/s00439-003-1031-4.
  4. Y Chromosome Consortium (2002-01-18). YCC NRY Tree 2002. Página visitada em 2007-12-13.
  5. Cengiz Cinniolu, et al.; Excavating Y-chromosome haplotype strata in Anatolia; Human Genetics; Volume 114, Number 2; January 2004, Pages: 127 - 148
Ícone de esboço Este artigo sobre Genética é um esboço. Você pode ajudar a Wikipédia expandindo-o.