Haplogrupo I-M253

Origem: Wikipédia, a enciclopédia livre.
Ir para: navegação, pesquisa
Haplogrupo I1 (M253)

HG I1 europa.jpg

Tempo de origem 3,170–5,070 A.D. ( anteriormente 11,000 A.D. a 33,000 A.D.)
Lugar de origem Norte da Europa
Ancestral I* (M170)
Descendentes I1a (DF29/S438);
I1b (S249/Z131);
I1c (Y18119/Z17925)
Mutações definidas M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

O haplogrupo I-M253, também conhecido como I1, é um  haplogrupo do cromossoma Y. Os marcadores genéticos confirmados como identificadores de I-M253 são os SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187. Ele é o principal ramal do haplogrupo I-M170 (I*).

O haplogrupo atinge o seu pico de frequências na Suécia (52% dos homens no Condado da Gotalândia Ocidental) e da Finlândia Ocidental (mais de 50 por cento na província de Satakunta ).[1] Em termos de médias nacionais, o I-M253 é encontrado em 35-38% dos homens suecos ,[2] 32,8% dos varões dinamarqueses, cerca de 31,5% dos noruegueses,[3] e cerca de 28% dos finlandeses do sexo masculino.[4]

O haplogrupo I-M253 é o principal ramal do haplogrupo I* (I-M170), que esteve presente na Europa desde os tempos antigos. O principal ramal de I* é o I-M438, também conhecido como I2.

Antes da reclassificação, em 2008,[5] o grupo era conhecido como I1a, um nome que já tem sido reatribuído para um ramal primário, haplogrupo I-DF29. Os outros principais ramais de I1 (M253) são I1b (S249/Z131) e I1c (Y18119/Z17925).

Origem[editar | editar código-fonte]

De acordo com um estudo publicado em 2010, o I-M253 originou-se entre 3,170 e 5.000 anos atrás, no período Calcolítico na Europa.[6] Um novo estudo, em 2015, estimativa a origem entre 3,470 e 5,070 anos atrás, ou entre 3,180 e 3,760 anos atrás, usando duas técnicas diferentes.[7] sugere-se que se dispersara inicialmente desde a área que hoje é a Dinamarca.[8]

Um estudo de 2014, na Hungria, revelou restos de nove indivíduos da Cultura da Cerâmica Linear, um dos quais levava o SNP M253 que define o haplogrupo I1. Pensa-se desta cultura  ter sido presente entre 6.500 e 7.500 anos atrás.[9]

Estrutura[editar | editar código-fonte]

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187) ou I1 [10]

  • I-DF29 (DF29/S438); I1a
    • I-CTS6364 (CTS6364/Z2336); I1a1
      • I-M227; I1a1a
      • I-L22 (L22/S142); I1a1b
        • I-P109; I1a1b1
        • I-L205 (L205.1/L939.1/S239.1); I1a1b2
        • I-Z74; I1a1b3
        • I-L300 (L300/S241); I1a1b4
          • I-L287
            • I-L258 (L258/S335)
          • I-L813
    • I-Z58 (S244/Z58); I1a2
      • I-Z59 (S246/Z59); I1a2a
        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
          • I-Z140 (Z140, Z141)
            • I-L338
            • I-F2642 (F2642)
          • I-Z73
            • I-L1302
          • I-L573
          • I-L803
        • I-Z382; I1a2a2
      • I-Z138 (S296/Z138, Z139); I1a2b
        • I-Z2541
    • I-Z63 (S243/Z63); I1a3
      • I-BY151; I1a3a
        • I-L849.2; I1a3a1
        • I-BY351; I1a3a2
            • I-CTS10345
              • I-Y10994
            • I-Y7075
        • I-S2078
          • I-S2077
            • I-Y2245 (Y2245/PR683)
              • I-L1237
                • I-FGC9550
              • I-S10360
                • I-S15301
              • I-Y7234
        • I-BY62 (BY62); I1a3a3
  • I-Z131 (Z131/S249); I1b
    • I-CTS6397; I1b1
  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Distribuição geográfica[editar | editar código-fonte]

I-M253 é encontrado na sua maior densidade no Norte da Europa e de outros países que sofreram intensa migração do Norte da Europa, bem no Período de Migração, bem na Era Viquingue ou bem em tempos modernos. Ele é encontrado em todos os lugares invadidos pelos antigos povos germânicos e os Víquingues.

Durante a era moderna, populações significativas do I-M253  também lançaram raízes nas nações de imigrantes de ex-colónias europeias, tais como os Estados Unidos, Austrália e Canadá.

População Tamanho da amostra I (total) I1 (I-M253) I1a1a (I-M227) Source
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Bielorrússia: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
Bielorrússia: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
República Checa 47 31.9 8.5 0.0 Underhill et al. 2007
República Checa 53 17.0 1.9 0.0 Rootsi et al. 2004
Dinamarca 122 39.3 32.8 0.0 Underhill et al. 2007
Inglaterra 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finlândia (nacional) 28.0 Lappalainen et al. 2006
Finlândia: Oeste 230 40 Lappalainen et al. 2008
Finlândia: Leste 306 19 Lappalainen et al. 2008
Finlândia : Satakunta 50+ Lappalainen et al. 20089
França 58 17.2 8.6 1.7 Underhill et al. 2007
França 12 16.7 16.7 0.0 Cann et al. 2002

(Baixa- Normandia)

42 21.4 11.9 0.0 Rootsi et al. 2004
Alemanha 125 24 15.2 0.0 Underhill et al. 2007


171 15.8 2.3 0.0 Underhill et al. 2007
Hungria 113 25.7 13.3 0.0 Rootsi et al. 2004
Irlanda 100 11 6.0 0.0 Underhill et al. 2007
Kazan Tártaros 53 13.2 11.3 0.0 Trofimova 2015
Letónia 113 3.5 Lappalainen et al. 2008
Lituânia 164 4.9 Lappalainen et al. 2008
Países Baixos 93 20.4 14 0.0 Underhill et al. 2007
Noruega 2826 31.5 Eupedia 2017 [precisa-se de fonte melhor?]

Rússia (national) 16 25 12.5 0.0 Cann et al. 2002
Rússia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
Rússia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Rússia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Rússia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Rússia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Rússia: Cossacos 89 24.7 4.5 0.0 Underhill et al. 2007
Rússia: Karelios 140 10 8.6 0.0 Underhill et al. 2007
Rússia: Karelios 132 15.2 Lappalainen et al. 2008
Rússia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
Eslováquia 70 14.3 4.3 0.0 Rootsi et al. 2004
Eslovénia 95 26.3 7.4 0.0 Underhill et al. 2007
Suécia (nacional) 160 35.6 Lappalainen et al. 2008
Suécia  (nacional) 38.0 Lappalainen et al. 2009
Suécia: Västra Götaland 52 Lappalainen et al. 2009
Suíça 144 7.6 5.6 0.0 Rootsi et al. 2004
Turquia 523 5.4 1.1 0.0 Underhill et al. 2007
Ucrânia: Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
Ucrânia: Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
Ucrânia: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
Ucrânia: Tcherkássi 114 28.1 4.3 0.0 Underhill et al. 2007
Ucrânia: Belgorod 56 26.8 5.3 0.0 Underhill et al. 2007

Suécia[editar | editar código-fonte]

Dinamarca[editar | editar código-fonte]

Noruega[editar | editar código-fonte]

Finlândia[editar | editar código-fonte]

A Grã-Bretanha[editar | editar código-fonte]

Mapa mostrando a distribuição de cromossomas Y numa trans seção de Inglaterra e país de Gales, desde o papel de "Cromossoma Y evidencia a migração em massa de Anglo-saxónicos". Os autores atribuem as diferenças nas frequências do haplogrupo I à migração Anglo-saxónica em massa para a Inglaterra, mas não para o país de Gales.

Em 2002 foi publicado um artigo por Michael E. Weale e colegas mostrando evidência genética das diferenças entre as populações inglesa e  galesa populações, incluindo um nível acentuadamente mais alto de haplogrupo I-ADN na Inglaterra do que no país de Gales. Eles viram isso como uma evidência convincente da invasão anglo-saxónica em massa do leste da Grã-Bretanha desde o Norte da Alemanha e a Dinamarca , durante o Período de Migração.[10] Os autores assumem que as populações com grandes proporções de haplogrupo I originaram-se a partir da Alemanha do norte ou sul da Escandinávia, nomeadamente a Dinamarca, e que os seus antepassados migraram através do Mar do Norte com migrações anglo-saxónicas e Víquingues dinamarqueses . A principal reivindicação dos pesquisadores foi:

que seria necessária a ocorrência naquela altura duma imigração anglo-saxónica afetando ao 50-100% do fundo genético dos homens da Inglaterra Central. Observamos, no entanto, que os nossos dados não nos permitem diferenciar um evento simplesmente adicionado ao fundo genético autóctone dos homens da Inglaterra Central doutro onde os homens autóctones foram deslocados algures ou onde os varões indígenas foram reduzidos em número ... Esse estudo mostra que a fronteira galesa era mais uma barreira genética para cromossoma Y anglo-saxão do que o fluxo de genes do que o Mar do Norte ... Estes resultados indicam que uma fronteira política pode ser mais importante que uma geofísica numa estruturação genética da população.

Distribuição dos haplogrupos do cromossoma Y de Capelli et al. (2003). O haplogrupo I está presente em todas as populações, com as frequências mais altas no leste e baixas frequências no ocidente. Parece não haver um limite descontinuo como observado por Weale et al. (2002)

Em 2003, um artigo publicado por Christian Capelli e colegas apoiara, mas modificadas, as conclusões do Weale e colegas.[11] Esse papel, que apresentou amostras Grã-Bretanha e da Irlanda numa grade, encontrou uma menor diferença entre amostras galesas e inglesas , com uma diminuição gradual na frequência no haplogrupo I movendo-se em direção ao oeste no sul da Grã-Bretanha. Os resultados sugerem aos autores que os invasores víquingues noruegueses influenciaram fortemente a zona norte das Ilhas Britânicas, mas que todas as amostras inglesas e escocesas da Grã-Bretanha possuem influência alemã/dinamarquesa.

Membros proeminentes da I-M253[editar | editar código-fonte]

Alexander Hamilton, através da genealogia e o teste dos seus descendentes (supondo a real paternidade correspondente à sua genealogia), foi colocado dentro do haplogrupo Y-ADN I-M253.[12]

Birger Jarl, 'Duque da Suécia"  da Casa dos Godos de Bjalbo, fundador de Estocolmo, cujos restos enterrados numa igreja testaram-se em 2002, e que se achou serem também I-M253.

Passageiros do Mayflower  William Brewster, Edward Winslow e George Soule através de testes de DNA

Marcadores[editar | editar código-fonte]

ADN: exemplo, cadeia 1 difere da cadeia 2 em um único par de base local ( un C >> T do polimorfismo).

As seguintes são as especificações técnicas para as mutações dos SNP e STR conhecidas do haplogrupo I-M253.

Nome: M253

Tipo: SNP
Fonte: M (Peter Underhill da Universidade de Stanford)
Posição: ChrY:13532101..13532101 (+ strand)
Posição (pares de base): 283
Tamanho Total (pares de base): 400
Comprimento: 1
Iniciador molecular F (espelho 5'→ 3'): GCAACAATGAGGGTTTTTTTG
Iniciador molecular R (complementar 5'→ 3'): CAGCTCCACCTCTATGCAGTTT
Alteração nucleotídeos alelos (mutação): C a T

Nome: M307

Tipo: SNP
Fonte: M (Peter Underhill)
Posição: ChrY:21160339..21160339 (+ strand)
Comprimento: 1
Alteração nucleotídeos alelos (mutação): G para A

Nome: P30

Tipo: SNP
Fonte: PS (Michael Hammer , da Universidade do Arizona e James F. Wilson, da Universidade de Edimburgo)
Posição: ChrY:13006761..13006761 (+ strand)
Comprimento: 1
Alteração nucleotídeos alelos (mutação): G a A
Região: ARSDP

Nome: P40

Tipo: SNP
Fonte: PS (Michael Hammer e James F. Wilson)
Posição: ChrY:12994402..12994402 (+ strand)
Comprimento: 1
Iniciador molecular: GGAGAAAAGGTGAGAAACC
Iniciador molecular R: GGACAAGGGGCAGATT
Alteração nucleotídeos alelos (mutação): C a T
Região: ARSDP


  1. Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). «Migration Waves to the Baltic Sea Region». Annals of Human Genetics. 72 (3): 337–348. PMID 18294359. doi:10.1111/j.1469-1809.2007.00429.x 
  2. Lappalainen, T.; Hannelius, U.; Salmela, E.; von Döbeln, U.; Lindgren, C. M.; Huoponen, K.; Savontaus, M.-L.; Kere, J.; Lahermo, P. (2009). «Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis». Annals of Human Genetics. 73 (1): 61–73. PMID 19040656. doi:10.1111/j.1469-1809.2008.00487.x 
  3. Eupedia, "Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in percentage" (31 January 2017) .
  4. Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp.207-15.
  5. Karafet, Tatiana M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). «New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree». Genome Research. 18 (5): 830–8. PMC 2336805Acessível livremente. PMID 18385274. doi:10.1101/gr.7172008 
  6. Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  7. «TMRCAs of major haplogroups in Europe estimated using two methods. : Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group». www.nature.com. Consultado em 19 de maio de 2015 
  8. Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42.
  9. Predefinição:Cite biorxiv
  10. a b Weale, Michael E.; Weiss, Deborah A.; Jager, Rolf F.; Bradman, Neil; Thomas, Mark G. (2002). «Y chromosome Evidence for Anglo-Saxon Mass Migration». Molecular Biology and Evolution. 19 (7): 1008–1021. PMID 12082121. doi:10.1093/oxfordjournals.molbev.a004160 
  11. Capelli, Cristian; Redhead, Nicola; Abernethy, Julia K.; Gratrix, Fiona; Wilson, James F.; Moen, Torolf; Hervig, Tor; Richards, Martin; Stumpf, Michael P.H.; et al. (2003). «A Y Chromosome Census of the British Isles» (PDF). Current Biology. 13 (11): 979–984. PMID 12781138. doi:10.1016/S0960-9822(03)00373-7 
  12. «Founding Father DNA». isogg.org 

Bancos de dados haplogrupo I

Haplogrupos do cromossoma Y humano

cromossoma Y comum a todos os homens
I J LT K-M526
R1 R2
R1a R1b

Existem vários bancos de dados de acesso público expondo o I-M253, incluindo: