Haplogrupo R1b (ADN-Y)

Origem: Wikipédia, a enciclopédia livre.
(Redirecionado de M343)
Ir para: navegação, pesquisa
Europa Y-DNA. Puzzles Princípio - As áreas destacadas, onde a freqüência de haplogrupos representam mais de um terço do pool genético (> 35%)
Haplogrupo R1b

Haplogroup R1b (Y-DNA).PNG

Tempo de origem < 18,500 anos[1]
Lugar de origem Sudoeste Asiático[2]
Ancestral R1
Descendentes R1b1a (R-P297), R1b1b (R-M335), R1b1c (R-V88)
Mutações definidas M343
Alta frequência Europa ocidental, Norte dos Camarões, Bashkires

Haplogrupo R1b (Y-DNA) é a linhagem paterna dominante da Europa Ocidental. Em genética humana o haplogrupo R1b é o mais frequente haplogrupo do cromossomo Y na Europa Ocidental e em partes da África sub-saariana Central (por exemplo em torno de Chad e Camarões). R1b também está presente em freqüências mais baixas em toda a Europa Oriental, Ásia Ocidental, Ásia Central e partes do norte da África, Sul da Ásia e Sibéria. Devido à emigração Europeia também atinge altas frequências nas Américas e na Austrália. Enquanto a Europa ocidental é dominada pela R1b1a2 ramo (R-M269) de R1b, a área de língua Chadic na África é dominada pelo ramo conhecido como R1b1c (R-V88). Estes representam dois "galhos" muito bem sucedidos em uma muito maior "árvore genealógica".

Fundamentos[editar | editar código-fonte]

O haplogrupo R1b é definido pelo marcador genético, M343 anunciado em 2004[3] , o qual define um polimorfismo binário específico no cromossomo Y. É agora definido como o haplogrupo R1b do cromossomo Y (anteriormente conhecido como Hg1 e Eu18).[4] Este marcador genético é portado pela maioria dos Europeus Ocidentais. É portado por 60% da população inteira de Portugal e de França, 70% da população inteira da Inglaterra e 90% de algumas partes de Espanha e Irlanda.

Três estudos genéticos recentes, de 2015, deram apoio à teoria de Marija Gimbutas de que a difusão das línguas indo-europeias teria se dado a partir das estepes russas (hipótese Kurgan). De acordo com esses estudos, o Haplogrupo R1b (ADN-Y) e o Haplogrupo R1a (ADN-Y) - hoje os mais comuns na Europa e sendo o R1a frequente também no subcontinente indiano - teriam se difundido, a partir das estepes russas, junto com as línguas indo-europeias; tendo sido detectado, também, um componente autossômico presente nos europeus de hoje que não era presente nos europeus do Neolítico, e que teria sido introduzido a partir das estepes, junto com as linhagens paternas (haplogrupo paterno) R1b e R1a, assim como com as línguas indo-europeias.[5] [6] [7]

Trabalhos de arqueologia contemporâneos associam a domesticação do cavalo a essa expansão.[8]

Os detalhes técnicos do M343 são:

  • Mudança de nucleotídeo: C a A
  • Posição (par de bases): 402
  • Tamanho total (pares de bases): 424
  • Forward 5′→3′: tttaacctcctccagctctgca
  • Reverse 5′→3′: acccccacatatctccagg

Isto refere-se a um particular fragmento de DNA de pares de bases que a reação em cadeia da polimerase produz quando um usa as duas cadeias "primárias" listadas.

M343 foi anunciado em um grupo de 21 novos marcadores do cromossomo Y em um artigo de Cengiz Cinniolu em conjunto com outros autores[9] e tem sempre sido usado em aplicações tais como o Projeto Genográfico. Note-se que M343 e M242 foram os únicos dois marcadores deste artigo usados por tal projeto.

Ver também[editar | editar código-fonte]

Haplogrupos ibéricos.png

Haplogrupos do cromossoma Y humano

cromossoma Y comum a todos os homens
I J LT K-M526
R1 R2
R1a R1b

Ligações externas[editar | editar código-fonte]


  1. Karafet, TM; Mendez, FL; Meilerman, MB; Underhill, PA; Zegura, SL; Hammer, MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research [S.l.: s.n.] 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274. 
  2. International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades
  3. Cinnioğlu, Cengiz; et al (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics [S.l.: s.n.] 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. 
  4. Y Chromosome Consortium (2002-01-18). "YCC NRY Tree 2002". Consult. 2007-12-13. 
  5. Haak et al (2015). Migração em massa da estepe é fonte das línguas indo-europeias na Europa (pdf publicado=2015) (em inglês) 172 pp.. Visitado em 6 de novembro de 2015.
  6. Allentoft et al (2015). Genética de populações da Eurásia à época da Idade do Bronze (pdf publicado=2015) (em inglês) 167 pp.. Visitado em 6 de novembro de 2015.
  7. Mathieson et al (2015). 8000 anos de seleção natural na Europa (pdf publicado=2015) (em inglês) 167 pp.. Visitado em 6 de novembro de 2015.
  8. O cavalo, a roda e a linguagem Como cavaleiros das estepes euroasiáticas, da Idade do Bronze, contribuíram para a formação do mundo moderno, por David W. Anthony, Editora Universidade de Princeton, "The Horse, the Wheel and Language, How Bronze-Age Riders from the Eurasian Steppes shaped the Modern World", 2007
  9. Cengiz Cinniolu, et al.; Excavating Y-chromosome haplotype strata in Anatolia; Human Genetics; Volume 114, Number 2; January 2004, Pages: 127 - 148
Ícone de esboço Este artigo sobre Genética é um esboço. Você pode ajudar a Wikipédia expandindo-o.