Telômero

Origem: Wikipédia, a enciclopédia livre.
Ir para: navegação, pesquisa
Telômero formando uma laçada.

Os telômeros ou telómeros (do grego telos, final, e meros, parte) são estruturas constituídas por fileiras repetitivas de proteínas e DNA não codificante que formam as extremidades dos cromossomos. Sua principal função é manter a estabilidade estrutural do cromossomo. Os telómeros estão presentes principalmente em células eucarióticas, visto que o DNA das células procarióticas forma cadeias circulares, logo não tem locais de terminação, embora existam exceções como: bactérias com DNA linear e que possuem telómeros.

Cada vez que a célula se divide, os telómeros são ligeiramente encurtados. Como estes não se regeneram, chega a um ponto em que não permitem mais a correcta replicação dos cromossomas e a célula perde completa ou parcialmente a sua capacidade de divisão. O encurtamento dos telómeros também pode eliminar certos genes que são indispensáveis à sobrevivência da célula ou silenciar genes próximos. Como o processo de renovação celular não tolera a morte das células antes da divisão correcta das mesmas, o organismo tende a morrer num curto prazo de tempo no momento em que seus telómeros se esgotam.

Os telómeros funcionam como um protector para os cromossomas assegurando que a informação genética (DNA) relevante seja perfeitamente copiada quando a célula se duplica. Os telómeros também protegem os cromossomas, de uma forma geral, da degradação, da recombinação e da translocação robertsoniana.

Os telómeros foram identificados pela primeira vez por Hermann Joseph Muller, na década de 30 do século XX. Mais tarde, em 1965, Leonard Hayflick fez a primeira observação direta do fenómeno de morte celular sem pré-replicação. Em homenagem ao cientista, o comprimento mínimo que os telômeros podem alcançar antes de causar problemas à divisão celular passou a ser chamado de Limite de Hayflick.

Estrutura dos telómeros[editar | editar código-fonte]

Na maioria dos organismos, os telómeros são formados por repetições simples de nucleotídeos. É essencial que o telómero esteja associado a uma proteína ou a um arranjo específico para que ele possa ser diferenciado das quebras cromossomáticas.

Nos seres humanos os telómeros são formados pela repetição de seis nucleotídeos: TTAGGG, que compreendem até dezenas de quilobases. Os telómeros humanos contêm ainda um pequeno trecho de fita simples com poucas centenas de nucleotídeos.

Acredita-se que pelo menos metade dos cromossomas dos mamíferos possui telómeros que formam um tipo mais complexo de arranjo, o chamado T-loop. Este T-loop tem entre cinco e dez mil bases de DNA e é catalisado pela proteína TRF2, que ajuda a estabilizar a extremidade do cromossoma. Além da presença de TRF2, a formação do T-loop depende também de mais dois fatores: repetições de fita dupla e repetições de fita simples.

Os telómeros são sintetizados no final da replicação do DNA pela enzima telomerase, que é uma transcriptase reversa, pois sintetiza DNA tendo por molde uma molécula de RNA.

Outras questões associadas[editar | editar código-fonte]

Telómero como relógio biológico[editar | editar código-fonte]

Toda vez que a célula se duplica ela também duplica os cromossomas. Este processo, como já mencionado, encurta os telómeros das células, portanto, teoricamente pode-se definir com exatidão a expectativa de vida de um ser vivo analisando quantos telómeros ainda restam em suas células, ou seja, quantas vezes as células ainda poderão se duplicar antes de o indivíduo morrer. Assim, os telómeros podem ser considerados sofisticados relógios biológicos.

Telómeros e clonagem[editar | editar código-fonte]

Por diversos motivos os telómeros também têm sido alvo de pesquisas no ramo da clonagem. O fato é que em todas as clonagens feitas através de transferência nuclear, o ser vivo clonado acaba por morrer muito precocemente. Exemplo disso é a ovelha Dolly[1] que envelheceu e morreu muito rapidamente. As células de um clone gerado por transferência nuclear são cópias de uma célula já adulta cujos telómeros já estão bastante encurtados, ou seja, a ovelha Dolly ao ser gerada tinha, biologicamente, a idade da ovelha que a originou, fato este que diminuiu drasticamente a sua expectativa de vida.

Telómeros e senescência celular[editar | editar código-fonte]

Os telómeros são alvo de pesquisas não apenas porque interessam ao ramo da clonagem, mas também porque acredita-se que eles estejam intimamente relacionados com o nosso ciclo de vida e morte. Sabe-se que existe uma relação entre os telómeros e a senescência celular, mas ainda não se sabe exatamente que relação é essa. Se, ao menos, metade das teorias a respeito dos telómeros estiver correta é bastante provável que prevenir o encurtamento dos mesmos seja uma das chaves para a superlongevidade.

Alguns cientistas sugerem que a perda dos telómeros apenas correlaciona com a senescência celular, não sendo assim a causa determinante da mesma. Um número crescente de evidências tem vindo a demonstrar que pode haver indução da senescência em presença de telômero de dimensões apreciáveis.

Outros estímulos, para além dos telómeros, também têm sido sugeridos como sendo indutores da senescência celular, dentre os quais podemos destacar a danificação do DNA e a ativação de oncogenes.

Prevenção do encurtamento do telómero[editar | editar código-fonte]

Nas células eucarióticas existe um complexo ribonucleoproteíco chamado telomerase que previne o encurtamento progressivo dos cromossomas derivado das sucessivas divisões celulares. A telomerase é uma enzima que adiciona sequências repetitivas à extremidade 3' do cromossoma. Para cumprir esta função a telomerase usa um molde de RNA para a produção do DNA (é um tipo de transcriptase reversa ou polimerase de DNA dependente de RNA). A extensão do cromossoma pela telomerase e o encurtamento provocado pela divisão celular é um processo de equilíbrio dinâmico. A telomerase está presente principalmente em células embrionárias e em tumores - já que além de prevenir o encurtamento dos telómeros (retardando o envelhecimento) também ativa genes que fazem a célula se dividir indefinidamente.

O número de vezes que esta enzima adiciona as sequências repetitivas de nucleotídeos não é controlado por ela própria, mas sim por outras proteínas envolvidas no processo.

O telómero permite a estabilidade do cromossoma e por consequência a sobrevivência da célula: a par de um centrômero para poder haver segregação cromossomática, de uma origem para poder haver a iniciação da replicação do cromossoma; a existência do telómero é um dos elementos mais básicos para a existência do cromossoma. A junção destes três elementos foi já testada no âmbito da produção de cromossomas artificiais.

Em 1998, a Geron Corporation começou a desenvolver técnicas e drogas para estender os telómeros e prevenir a senescência celular.

Algumas sequências de telómeros conhecidas:
Grupo Organismo Repetição (5' > 3')
Vertebrados Humano, Rato, Xenopus TTAGGG
Fungos filamentos Neurospora crassa TTAGGG
Micetozoários Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Protozoários (Kinetoplastea) Trypanosoma, Crithidia TTAGGG
Protozoários ciliados Tetrahymena
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Protozoários (Apicomplexa) Plasmodium TTAGGG(T/C)
Plantas superiores Arabidopsis thaliana TTTAGGG
Clorófitos Chlamydomonas TTTTAGGG
Insetos Bombyx mori TTAGG
Nemátodos Ascaris lumbricoides TTAGGC
Leveduras Saccharomyces cerevisiae

Candida glabrata

Candida albicans

Candida tropicalis

Candida maltosa

Candida guillermondii

Candida pseudotropicalis

Kluyveromyces lactis

TGTGGGTGTGGTG

ou G(2-3)(TG)(1-6)T

GGGGTCTGGGTGCTG

GGTGTACGGATGTCTAACTTCTT

GGTGTA[C/A]GGATGTCACGATCATT

GGTGTACGGATGCAGACTCGCTT

GGTGTAC

GGTGTACGGATTTGATTAGTTATGT

GGTGTACGGATTTGATTAGGTATGT

Ver também[editar | editar código-fonte]

Referências[editar | editar código-fonte]

  1. Alexander J. Kind, Keith H.S. Campbell, Ian Wilmut, David Waddington, Alan Colman, Angelika E. Schnieke (1999), Analysis of Telomere Length in Dolly, a Sheep Derived by Nuclear Transfer, v. 1, n. 2, p. 119 - 125 (em inglês)
  • Lewin, Benjamin (1999), Genes VII. Oxford University Press, USA. ISBN 0-19-879276-X
  • Lodish, H.; Berk, A.; Zipursky, S.; Matsudaira, P.; Baltimore, D.; Darnell, J. (1999), Molecular Cell Biology. W.H. Freeman & Company; 4th ed. ISBN 0-7167-3706-X
  • Witzany, Guenther (2008), The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance". Biosemiotics 1: 191-206.

Ligações externas[editar | editar código-fonte]